pughlizz1521 pughlizz1521
  • 25-04-2020
  • Biology
contestada

What is a seed discovered and when planted grew to be a large flowering plant

Respuesta :

0799656
0799656 0799656
  • 25-04-2020

Answer:

Can you restate your question. That is way to broad

Explanation:

Answer Link

Otras preguntas

What is |-26|? (a) -26, (b) 26, (c) 0, (d) 1
HELP PLEASEEE!!!! The mass of a proton in scientific notation is 1.6 x 10-24 grams. What is the mass of a proton in standard form? a. 0.000000000000000000000001
What is the difference between design and technique? a. Design refers to the overall organization of a work of art, where as technique refers to the materials t
Morgan rewrote the expression 90 + (10 + 4.8) as (90 + 10) + 4.8. How will this change the work that is needed to evaluate the expression?
El tapatea del cuento en el fondo del caño hay un negrito
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
What method can scientists use to determine the absolute age of a rock?
What are some ways the names can be empowered
What characteristics of polyethylene glycol (PEG) make it an excellent substance for the liquid inside the paintballs?
In the statement from the Declaration of Independence we hold these truths to be self evident what truths are they talking about