montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

Probably the main reason Africans, rather than Native Americans, became slaves in America was that? A. Indians passed North American diseases to the Europeans.

what was the Powhatan confederacy and how did the group interact with the British settlers

Cecilia is making shorts with 8 belt loop. To make the loops, she needs 8 strips of fabric. Each strip measures 1 1/4 inches wide and 7 inches long. What is the

the two main types of fermentation are called what

Why will a decrease in pH of the stomach affect protein digestion? Decrease in pH of the stomach will distort the structure of peptides in food, which affects t

Which term correctly identifies the underlined words in the sentence? When books have tiny print, the words are difficult to read. A. participle B. participi

true or false: Penicillin, ampicillin, and bacitracin work by disrupting the synthesis of ribosomes True or false: drugs that disable or kill infectious bacteri

x • x = 2x need help

I need help please Find the value of numerical expression can you explain it to me please 2^4

If a person has memory B cells against a certain pathogen, the person is.. a) likely to develop that disease b) much less likely to develop the disease a second