christopherh0503 christopherh0503

23-04-2020
History

contestada

what two counties became rivals in east africa

Respuesta :

Аноним Аноним

23-04-2020

Answer:German East Africa was a German colony in the African Great Lakes

Answer Link

Otras preguntas

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please

2 Points True or False? If two chords intersect inside a circle, the angles formed are called inscribed angles. A. True B. False SUBMIT

The diagram below shows the chromosomes from a cell after they were photographed under a microscope. Which of the following questions may best be answered by st

what is 33.4% of 104?

Question #2 What is the slope-intercept form of the equation of a line? Selectone correct answer.Oy=kxy-k=m(x-h)Oy=mx+bOAX + By = C

How did the the RMS Carpathia sink?

2 cannons fire projectiles upwards with the same velocity. The cannonball on the left has 4 times the mass of the cannonball on the right. What can be correctly

TriangleABC has three sides with these lengths: AB=9, BC=40, and CA=41, What is the value of cos C?

I need to figure out what x is

What was the term used by Southerners for a return to Democratic, white rule? O A. Revelation O B. Redemption C. Restoration D. Limitation