helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

how would the population and enviroment change if the deer can only produce at a rate of 1 deer every two years provided that the same limiting factors are stil

In the results of the experiment in "the lowest animal," the cat does not deliberately terrify the mouse. it does not know the mouse is suffering. true or false

What is the equation of the exponential graph shown?

How many years before the civil war did brown carry out his raid?

If one species in a community dies out or moves, the community will

Write a balanced chemical equation for the reaction. na2co3 and agno3

Consuming excess amounts of the water-soluble vitamin c can lead to _______.

Why is digestion a necessary process for animals?

Your weight depends on A. your mass B. your distance to the center of the Earth C. the earth's mass D. A, B, and C E. none

What was the location target for the telegraph 1800?