queenkeke queenkeke
  • 23-04-2018
  • Social Studies
contestada

what did emile durkheim say about social deviance

Respuesta :

juliebye81p4rvh8 juliebye81p4rvh8
  • 23-04-2018
he argued that deviance is a natural and necessary part of society but that it's actually impossible not to have deviance in a functional society. 
Answer Link
chmereaustin1 chmereaustin1
  • 01-10-2018

It encourages social change!!!!

Answer Link

Otras preguntas

Does this represent a linear function?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
help me please ,,,,,,,,ex 6 ,pleaseeee
What impact did Babe Ruth have on the society/country?
George tells you that when variables are in the denominator, the equation four over five plus three over x equals one over two becomes unsolvable. George explai
What is a vestigial organ
How can you use this document to argue that imperialism(colonization) was one underlying cause of world war I?
if if x+y=10, find the value of y when x=3
what percent of 137.4 is 96
which of the following expressions is equal to 1? a. 5^0 x 6^-3 x 6^3 x 5^1 b. 5^2 x 6^-2 x 6^3 x 5^-3 c. 5^2 x 5^-2 x 6^0 x 6^2 d. 5^-1 x 6^5 x 6^-5 x 5