BigDaddyChyna BigDaddyChyna

23-04-2018
Mathematics

contestada

Which statement of linear inequalities is represented by the graph

Which statement of linear inequalities is represented by the graph class=

Respuesta :

MrGumby MrGumby

25-04-2018

C. This is because the lines of the graphs can be seen using these. The inequality symbols in this case do not help you make the decision.

Answer Link

Otras preguntas

Researchers (Ambady and colleagues) demonstrated that student impressions of professors formed after observing only ten seconds of behavior __________. A. were

Which account has the lowest minimum balance requirement?

To decorate a cake, you make a shade of orange icing using 24 drops of red food coloring for every 8 drops of yellow. How many drops of yellow food coloring wou

the edwards's theater chain has studied its movie customers to determine how much money they spend on concessions. the study revealed that the spending distribu

given main() and product.h, define the product class (in product.cpp) that will manage product inventory. product class has three private data members: a produc

Hierarchical organization and chemical complexity can be exemplified by the Saguaro desert as the ecosystem. Provide an example for each of the other six hierar

a ball is thrown upward. at a height of 10 meters above the ground, the ball has a potential energy of 50 joules (with the potential energy equal to zero at gro

China's high-speed rail network calls for a minimum turn radius of 7.0 km for 350-km/htrains.What's the magnitude of a train's acceleration in this case?Express

a successful awareness campaign ran with a 30-second video ad. you now want to remarket to audiences who saw it with memorable, shorter video ads. what video ad

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?