CookieKitty
CookieKitty CookieKitty
  • 23-03-2018
  • Mathematics
contestada

Please help ! The choices are
11
65
8
44
:)

Please help The choices are 11 65 8 44 class=

Respuesta :

Аноним Аноним
  • 23-03-2018
31% = Roses - 0.31(72) = 22.32 [Rounded - 22]
21% = Daises - 0.21(72) = 15.12 [Rounded - 15]
11% = Sunflowers - 0.11(72) = 7.92 [Rounded - 8] 
12% = Carnations - 0.12(72) = 8.64 [Rounded - 9]
18% = Tulips - 0.18(72) = 12.96 [Rounded - 13] 

Your answer is: 8
Answer Link

Otras preguntas

Pls help dew today i also need help with Science
particles are very ..........​
what is this??????????​
Find the product 2 3 3 of 580 points ​
Josh has 75 oranges and 675 apples. What percentage of the fruit is apples?
the plasma membrane of a cell is selectively permeable, which means it
. If you walk around a circular path TWICE, and the circle has a diameter of 100 m, how far did you walk in TOTAL?
two stores sell cds in packages, as shown in the table below.
What document(s) ended slavery?
transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC​