Leeomie7406 Leeomie7406

25-02-2018
Mathematics

contestada

A restaurant owner spends 892 for 65 pounds of produce. Which equation could you use to find the price per pound

Respuesta :

sqdancefan sqdancefan

27-02-2018

(price/pound)*65 = 892

Answer Link

Otras preguntas

What are the advantages and disadvantages of using a grid? In radiology

War hero during WWI who received the Medal of Honor and had 132 Germans surrender to him

In the debate regarding premenstrual dysphoric disorder, which argument(s) are against regarding this condition as a mental disorder?A. The condition is better

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

How many "for cause" exemptions does a lawyer get to use?

A cat rides a merry-go-round turning with uniform circular motion. At time t1=3.30 sec, the cat's velocity (in m/s) is 4.80i+2.60j measured on a horizontal xy c

Which of the following is a current controversy with Broca's aphasia?O Broca's aphasia is far too frequently diagnosed and may actually subsume other subtypes o

Our client argues that "eating fruits and vegetables generates a positive externality." Discuss whether this is the case and how a subsidy can address this. Whe

Many modern film composers have incorporated _________ in their music, a technique found in concert works by Wagner. a) endless melody b) unresolved dissonances

The price (in dollars) and demand for wireless headphones are related by x=6,000-0.15p². The current price of 110 is decreasing at a rate of 6 per week. Find th