Seudónimo Seudónimo

24-01-2018
Biology

contestada

Which is a reason farmers may choose to plant genetically modified crops?

Respuesta :

monique50 monique50

24-01-2018

They grow much faster and they grow to be larger than normal crops.

Answer Link

24-01-2018

A is the only one that makes sense here :)

Answer Link

Otras preguntas

if an element has more than one ionic change how is that piece of information represented in the chemical name

who is the first presiden of United States?

Elaine bought a total of 15 shirts and pairs of pants. She bought 7 more shirts than pants. How many of each did she buy?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what's the possibility of choosing a spade in a deck of 52 cards?

In a population of skunks, there are striped and stripeless individuals. Stripes are dominant to the absence of stripes. In this population, p = 0.8 and the fre

why does a virus stay in a person for life, such as hepatitis

Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq

Rulers of the Zhou dynasty established the Mandate of Heaven to ________.

If two solutions differ in their [H3O+] by a factor of 2.0, the difference in their pH will be 2.0.