mcduffiechloe mcduffiechloe

25-12-2017
English

contestada

Which movement followed the Brown v. Board of Education decision?

Respuesta :

Аноним Аноним

25-12-2017

Which movement followed the Brown v. Board of Education decision?
And the answer is desegregation.

Answer Link

21-02-2020

Answer:

The movement is desegregation

Answer Link

Otras preguntas

Number 5. I know the answer is 76 but how is that supposed to be shown in a bar model with common core?

PLEASE HELP ASAP 20 POINTS!! I am genuinely so lost, I don’t know what equation to use for any of these and it’s due tomorrow!!! I’ll take any help

In your own words describe how mountains are formed at both convergent plate boundaries and divergent plate boundaries.

Discussion Topic Using complete sentences post a detailed response to the following. What inspires you to create art? Feelings? Experiences? Things that you see

PLEASE HELP ANSWER >>> A local boutique sells water bottles for a set price, plus an additional fee for each letter that customers want laser engraved

if ∠G ≅ ∠H, then ∠H ≅ ∠G name the property

How much of a song can I use in a project?

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

Who was considered the father of the modern assembly line?.

Read the excerpt from "The Masque of the Red Death” by Edgar Allan Poe. Based on the details in the excerpt, what is the primary purpose of this passage?