khushboogarg7972 khushboogarg7972
  • 24-11-2017
  • Social Studies
contestada

Restoration of the integrity of myelin sheaths would likely result in a slowing or stopping of the progression of:

Respuesta :

W0lf93
W0lf93 W0lf93
  • 06-12-2017
Multiple sclerosis would likely be slowed if the myelin sheaths were restored. This disease is manifest by a degradation of the sheaths along the neuronal bodies, which leads to a delayed (or diminished) ability for a person to carry a signal along these neurons, and a diminished capacity for movement.
Answer Link

Otras preguntas

Does anyone know how too do this please I need help
In the mid-13 century, which group destroyed Baghdad?
add a new row to a table by clicking
If a container contains 18,000 ounces (oz) of beans, about how many pounds (lb) does it contain? [1 pound = 16 ounces] 70 lb 1,125 lb 180 lb 288,000 lb
Which BEST describes where the election process begins? A) nominations B) party caucus C) local conventions D) voter registration
Find the length of one edge of the cube. Edge length = Answer inches
the amount of money spent weekly on cleaning maintenance and repairs at a large restaurant was observed over a long period of time to be approximately normally
What is the ratio 15:75 written in lowest terms
How to find point slope equation from (-1,-10) and (5,2) Y-2=???
DNA tacaggtacccgaacccaattta