leviwagner27 leviwagner27

23-10-2017
History

contestada

Which turning point of World War I helped to establish the United States’ role as a superpower?

Respuesta :

coochicans coochicans

23-10-2017

They are most likely talking about the....

Wilson's Fourteen Points

Answer Link

Аноним Аноним

18-07-2019

Answer:

Wilson's Fourteen Points

Explanation:

Answer Link

Otras preguntas

A yellow and green car traveled 400 miles to Dayton, OH. The green car made the trip in 10 hours. The yellow arrived in 8 hours. Calculate the speed of each

What types of organisms have ligaments?

Blake was learning to drive. With his father, he drove 9⁄10 of a mile. With his mom, he drove 1⁄2 of a mile. How far did Blake drive in all?

Ted bought 3 blue shirts and 4 white shirts. If each shirt was $5, how much did Ted spend on these shirts?

DNA tacaggtacccgaacccaattta

The diameter of the circle is 59 centimeters. What is the approximate area of the circle

welp Mr. Shae’s class is having a discussion about the writings of Shakespeare. One student says, "One theme found in Romeo and Juliet is that love can cause vi

Can someone help me pls if u do your the best person ever

Which helps prevent errors in DNA replication? A.) Ribosome enzymes prevent errors from happening B.) Helicase enzyme checks the DNA for errors C.) DNA contain

Discuss the form of nationalism that prevailed in Europe before world war 1, and explain how it contributed to the start of the war