cierrawilson8015 cierrawilson8015

26-05-2017
Mathematics

contestada

What is the slope of the line that contains the points (–2, 5) and (6, –3)?

a 1
b8
c-1
d-8

Respuesta :

rodriquezmarie rodriquezmarie

26-05-2017

sorry if it is wrong but i think it is -8

Answer Link

Apraxus Apraxus

17-10-2018

its C: -1 thanks for failing me ^

Answer Link

Otras preguntas

What are the adaptive immune responses induced following acute and chronic infection with HIV?

Sam has type A blood. Which of the following blood types are NOT at all possible for Sam's offspring? Sam has type A blood. Which of the following blood types a

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

if if x+y=10, find the value of y when x=3

A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.

. Green swordtails are sexually dimorphic: males have a long, swordlike projection from their tails, and females have rounded tails. An experimenter decides to

What was the primary reason for the English colonization of Jamestown in 1607 near the James river

1+4=5 2+5=12 3+6=21 8+11=

Is sextillion a real number?

Assuming the average composition of air weighs approximately 0.0807 lbs per cubic foot, what is the weight of air in a giant spherical balloon with a diameter o