underroose underroose

22-07-2022
History

contestada

How did Greek dominance in the Mediterranean help to spread Jewish ideas in that area?

Respuesta :

Аноним Аноним

22-07-2022

Answer:

Greek dominance in the Mediterranean help spread Jewish ideas by having a Greek versions of the Hebrew Bible.

Explanation:

Answer Link

Otras preguntas

Family values in Ancient Rome included obedience to elders and devotion to the gods

what would you call a object that makes people shut up

An air force plane flew to Jakarta and back. On the trip there it flew 480 km/h and on the return trip it went 288 km/h. How long did the trip there take if the

If y= 4x +5 has a gradient of 4 write the equation of a line parrellel to it?

which process do scientists think provided earth with an oxygen- rich atmosphere

What is the significance of the similar number and arrangement of bones in a human arm and a bat wing?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

182,886 rounded to the nearest tenth

Write a recursive function for this sequence 8,12,18,27..

Suppose scientists found parts of the DNA from a dinosaur. What info would this discovery provide? What info would it not give them?