michaelissebastian77 michaelissebastian77
  • 23-04-2022
  • Mathematics
contestada

KLMN ~ PQRS. Find the given side length or angle measure.

KLMN PQRS Find the given side length or angle measure class=

Respuesta :

jdoe0001 jdoe0001
  • 23-04-2022

let's keep in mind that the shapes are both congruent, and let's also notice the letters sequence, KLMN is congruent with with its corresponding sides and angles at PQRS, so the PS side will be corresponding with the NK side, and the angle at M is the same as the angle at R, Check the picture below.

Ver imagen jdoe0001
Answer Link

Otras preguntas

True or false please help this is all due in 54 minutes!!!
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
Delegates from which state took part in the meeting to form a new Confederate government in February 1861? Maine Kentucky Missouri Mississippi.
why did the Jewish faith puts so much emphasis on the home and family
What point of view tell how people feel
80 ones = _ tens = - Eighty
Which of the following graphs represents the equation y=-2x + 3?
Help with astronomy please and thank you
x: 7x2-3x=2 ALGEBRA TWO
books in library6/7 are fiction, 5/7 are paperback, what fraction of books in library are fiction and paperback?