Lilililihodem Lilililihodem
  • 26-01-2017
  • Mathematics
contestada

A recipe of pasta makes enough for eight servings. How many servings can be made using 4/8 of each ingredient in the recipe?

Respuesta :

jdoe0001 jdoe0001
  • 26-01-2017
[tex]\begin{array}{ccllll} recipe&servings \\ \textendash\textendash\textendash\textendash\textendash\textendash&\textendash\textendash\textendash\textendash\textendash\textendash\\ 1&8\\ \frac{4}{8}&x \end{array}\implies \cfrac{1}{\frac{4}{8}}=\cfrac{8}{x}\impliedby \textit{solve for "x"}[/tex]
Answer Link

Otras preguntas

can you please help me please
what is similarities and differences freedmen and serfs?
182,886 rounded to the nearest tenth
what number must you add to the polynomial below to complete the square? x^2-x A. 1/4 B. 1/2 C. 2 D. 1
What is double consciousness
Why wood suitable to build boats and rafts
A cargo plane flew to Moscow and back. It took six hours longer to go there than it did to come back. The average speed on the trip there was 152 mph. The avera
Pythagorean Theorem: Alex leaves home, travels 5 miles east, and arrives at the library. He leaves the library and travels 3 miles north to a friend's house.
Marley has read 112.5 pages of a book. By the end of today, she plans to have read at least a total of 360 pages. If she reads 45 pages per hour, what is the mi
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC