tavialivingston442 tavialivingston442

26-02-2022
Mathematics

contestada

If the diameter of a circle is 3 feet what is the circumference

Respuesta :

britfessenden britfessenden

26-02-2022

Answer:

9.42

Step-by-step explanation:

C=2πR

because your diameter is 3, your radius is 1.5, so just plug in your number.

C=2π(1.5)

C=9.42

Answer Link

Otras preguntas

cinco reglas del béisbol

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

Complete the chart about British actions that lead the colonies to independence.The Sugar Act-Date Action Reaction

[Humans and The Environment] 1.How do competition, predation, and symbiosis impact the biological environment? 2.What is carrying capacity? 3.How are demographi

What is the primary benefit of a licensing agreement for the licensor? 1) Increased revenue 2) Reduced risk 3) Expanded market reach 4) Improved brand recogniti

Write a story for this division equation: 123 = 16

Wymień wady i zalety polskiego systemu emerytalnego

Janey is a landscaper at a tennis and golf club. She handles all aspects of maintenance from mowing to the care of all greenery on site. When the club owner con

How was this area restricted to commercial developers?

The temperatures shown below were recorded during a 12-hour period in Chicago. (a) At what time was the temperature the highest? Lowest? (b) How fast was the te