littlemuffin1v1 littlemuffin1v1

26-01-2022
Mathematics

contestada

Which expression represents the following statement? The quotient of 16 and 4 times 7 less than 11.

Respuesta :

fishtuna420 fishtuna420

26-01-2022

Answer:

16/4 x 7 - 11

Step-by-step explanation:

Your first dividing 16 and 4 so you would write, 16 divided by 4. Then you would have to multiply 7 subtracted by 11.

Answer Link

Otras preguntas

Which of the following best describes the maya civilization?.

Lily has 7 fewer ribbons than Dora. Lily has 13 ribbons. How many ribbons does Dora have?

The diameters of a circle is 7m. Find its area to the nearest tenth?? Help please

30 points!!!! 2K + 2H2O → 2KOH + H2 This reaction shows which detail about potassium and hydrogen? Hydrogen is more reactive than potassium. Potassium and hydr

Steve checked out a book and a video from the local library. They were three days overdue when he returned them. The fine was 15 cents for each day the book was

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

What is 50 million + 32 hundred thousands + 41 hundred

Janet is playing a game in which she interacts with an environment to solve a puzzle and to meet new characters. She really enjoys this game because there are n

Which effect are children who receive unconditional love most likely to display?.

16 = ОА. 4 ОВ. 3 ОС. 8 O D. 6