elgamela28 elgamela28

25-01-2022
Mathematics

contestada

write a divison equation that represents the question: how many 3/8 are in 5/4. more specific answer thanks

Respuesta :

mathstudent55 mathstudent55

25-01-2022

Answer:

3 1/3

Step-by-step explanation:

x = (5/4) / (3/8)

x = 5/4 × 8/3

x = 40/12

x = 10/3

x = 3 1/3

Answer Link

Otras preguntas

PLEASE HELP ITS A TIMED TEST A function, h(x). is defined as shown. - 4 xso 4 1-4 h(x) = -3, 0 1 1/4 x -2, x 24 Which graph represents h(x)?

In the past month Melissa went to buy video games and 7 DVD the rental price for each video game was $3.10 the rental price for each DVD was $3.70 what is the t

How does your body respond to an increase in the need for energy----why would you need more energy?

Complete the sentence with the correct answer. explain research. An essential question helps to describe,explain or focus

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

What is a major event in the passage above? OA. Alice falls down a rabbit-hole without knowing where it ends. OB. Alice peeps into the book that her sister is r

name the 5 pagraph names of an essay

Find the value of x?

Help me :) Please and Thanks

3/2x-5=-4/7x+1/5 please