yanderetime
yanderetime yanderetime
  • 21-10-2021
  • Mathematics
contestada

Drag each label to the correct location.
Use what you’ve learned about proportional relationships to classify these equations as direct variation, inverse variation, or neither.
PLEASE HELPPP

Drag each label to the correct location Use what youve learned about proportional relationships to classify these equations as direct variation inverse variatio class=

Respuesta :

xavieroglesby1011 xavieroglesby1011
  • 28-10-2021

Answer:

Step-by-step explanation:

Ver imagen xavieroglesby1011
Answer Link

Otras preguntas

Plsssssssss HELP!!!!!!!!!
What is the length of XY?
During development individual cells of the same organism begin to produce different proteins because.
QUESTION 22 PLEASE HELP ME!!!!
Transport in plants take place through a system of tube called
An aqueous solution was prepared by dissolving 266.07 g of AgNO3 ( 169.88 g/mol) in enough water to make a total volume of 250.0 ml. What is the molarity of the
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Can you help me explain
16. Which of the following situations is represented by the graph? A conversion of inches to yards B conversion of feet to inches c conversion of miles to feet
I’ll give 5 stars but you have to explain how you got 4.