Falconmaster Falconmaster

21-12-2016
History

contestada

A revolt of Californians in the Sacramento valley was led by:

John Fremont
Stephen Kearney
Zachary Taylor

Respuesta :

hiimruma hiimruma

21-12-2016

OK so the revolt that happened in Sacramento Valley was led by John Fremont.

Answer Link

leeshaffers leeshaffers

21-12-2016

Stephen Kearney is who led them

Answer Link

Otras preguntas

Which answer best describes the complex zeros of the polynomial function? f(x) = 13 - 22 + 6x - 6 The function has two real zeros and one nonreal zero. The grap

Two atoms of element Q mixed with element E

On a piece of paper, graph f(x) = 4x. Then determine which answer choice matches the graph you drew.

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Formulate a hypothesis based on something recently observed. And How could this hypothesis be tested?

who was the founder north carolina

1. ¿Dónde está la cafetería? 2. ¿Cuántos estudiantes hay en la cafetería? 3. ¿Cómo descansa Mercedes? 4. ¿Por qué estudia en la cafetería?

Use the information in the diagram to determine the height of the tree. The diagram is not to scale.

Match each key idea from the text to how it is emphasized in an image. Senator Kennedy suffered crippling pain in his back from football and wartime injuries an

Identify each type of rocks in map