tarlsyy390 tarlsyy390
  • 24-09-2021
  • Mathematics
contestada

Show ur
Work and check it help wit both

Show ur Work and check it help wit both class=

Respuesta :

christa215
christa215 christa215
  • 24-09-2021

9/ answer 80

I hope help you

Answer Link
doomdabomb
doomdabomb doomdabomb
  • 24-09-2021
Answer:

x = 80, w = 14

Step-by-step explanation:

x - 60 = 20

x = 60 + 20

x = 80

w + 14 = 28

w = 28 - 14

w = 14
Answer Link

Otras preguntas

how did Thomas Edison contribute to the Industrial Revolution
What is the Rub' al Khali? an area of fertile land in the central Arabian Peninsula a river in the northern Arabian Peninsula a forest in the southwestern Arabi
john bought a used truck for $4,500 he made an agreement with the dealer to put $1,500 down and mae payments of $350 for the next 10 months the extra cost paid
Which one of the following statements expresses a true proportion? A. 2 : 3 = 3 : 2 B. 3 : 5 = 12 : 20 C. 42 : 7 = 6 : 2 D. 14 : 6 = 28 : 18
1. The chart below shows changes in the length of a tree's shadow during a sunny day. (5.2.D) LENGTH 8:00 AM 2 meters 9:00 A.M. 1 meter 10:00 A.M. 0.5 meter 12:
what the decimal of 2 1/4
This is Super Confusing to me
The radius of the planent venus is nearly the same as that of the earth,but its mass is only eighty percent that of the earth. If an object weighs w on the eart
Why does Vivien say that she “shan't tell” Lancelot’s identity to her friend in King Arthur's Socks: A Comedy in One Act?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC