flufmar flufmar
  • 22-09-2021
  • English
contestada

If an advertisement tells you that the product worked for one person, so it must work for you, the advertisers are using _

generalization
bandwagon
Scare tactics
exaggeration

Respuesta :

t8um
t8um t8um
  • 22-09-2021

Answer:

Generalization

Explanation:

assuming a product will work for one person because it worked for another is generalizing.

Answer Link

Otras preguntas

1+4=5 2+5=12 3+6=21 8+11=
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What's x² + 2x + 1 factorised?
Each of the mutants listed below this paragraph has a different mutant form of the gene encoding protein X. Each mutant gene contains one or more nucleotide ins
how are the four earths systems connected
how would living in Sparta or Athens be like
Fred has an extremly rare autosomal recessive disease, so what is the chance that both of his grandfathers are carriers? Our teacher said this homework assignme
how many atoms are present in 4.0 mol of sodium
The tube that connects the bladder and the outside is called the
what type of sentence is used to give a command