201101174 201101174

22-09-2021
Mathematics

contestada

if 10 is subtrated from a number, the result is 23

Respuesta :

Mykie2020 Mykie2020

22-09-2021

Answer:

The number is 33

Step-by-step explanation:

23+10= 33

Hope this helps! :)

Answer Link

Otras preguntas

What was Texas before it became a state of the U.S.? Country Province Territory City

Find the value of x I need help ASAP.

I waited for my friend until he __________ . (To come)

There is a large concentration of which of these inside muscles? A. protein B. enzyme C. peptides

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

RIGHT ANSWER GETS BRAINLIST It has been estimated that among the Cherokee by 1863 one-third of the married women had become widows, and one-fourth of the child

Which theorem proves these triangles are similar?

Use algebra tiles to solve –x-7=-12

2-ODA Semester 2 Question 1 1 pts Choose the answer with the correct punctuation. S -Button To truly appreciate Groundhog Day it's best to find out whether or n

Ground squirrels inhabit African savannas . Which adaptation helps the ground squirrels live in this biome ? tan coloring to blend in with the surroundings thic