MaxRedDragon MaxRedDragon
  • 25-08-2021
  • Physics
contestada

Photoelectric effect occurs when frequency Ν of incident photon is
a. Ν < Ν 0
b. Ν = Ν 0
c. Ν = > Ν 0
d. Ν = 0

Photoelectric effect occurs when frequency Ν of incident photon is a Ν lt Ν 0 b Ν Ν 0 c Ν gt Ν 0 d Ν 0 class=

Respuesta :

matthewvalentino182 matthewvalentino182
  • 25-08-2021

Answer:

C from the picture

Explanation:

Answer Link

Otras preguntas

Thematic writing statement for the paper menagerie​
En cada uno de los vértices de un triángulo equilátero 30 cm de lado se encuentran cargas de 5 × 10-8 C, 8 x 10-8 C y -4 x 10-8 C. Calcular: La energia potenci
CHAPTER 6 QUESTIONS 3 AND 4
True or false ?Members of the same social class may have very different economic conditions
Suppose that f is a linear function with slope -3.2 and that f(1) = 8. What value of x gives f(x) = 0?
help me please show your solution ​
The pieces of ice float on water ? give reason​
why is life expectancy low when people per doctor is high?
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
PLEASE HELP URGENT Solve for the perimeter of the square, please show work!!!!!