tanyasingh21 tanyasingh21

26-03-2021
Biology

contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946 annaclaire946

26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

To keep african americans from voting, some southern states charged a(n) _____________ to cast a ballot?

sa solution is made by dissolving 26.42 g of (NH4)2SO4 in enough H2O to make 50.00 mL of solution. what is the molarity of the solution

if you throw a pebble into a glass of hot water, is the resulting mixture a solution?

Are the associative properties true for all integers? Explain.

Which of the following is based on poetry but is a work in a different genre? A.Waiting for Godot B.Cats C.Lord of the Flies D.The Guyana Quartet

what is the difference between concealed and revealed

Maria is playing a video game. She earns 15 points when she completes Level 1. Each time she completes a level, she earns twice as many points as the previous l

Which is true regarding ex post facto laws? A. Only the states may pass ex post facto laws. B. Only Congress may pass ex post facto laws. C. Ex post facto laws

This excerpt from Annus Mirabilis by John Dryden speaks about London after it was ravaged by fire and plague. What is the central idea of the excerpt? More gre

If a TV program is funny, which word would you use to describe it? a. fascinante b. tonto c. comico d. infantil