heatherfalor3456 heatherfalor3456

24-03-2021
Mathematics

contestada

3. Find the volume of the cylinder. Round to the nearest tenth.

3 Find the volume of the cylinder Round to the nearest tenth class=

Respuesta :

ardz1212 ardz1212

24-03-2021

the answer is 1943.86

Answer Link

Otras preguntas

The role of media on reporting human rights violation

An essay that uses the words first, next, and finally indicates what type of organization?

Which viruse reproduces & what reproductive cell ?

Joe has eaten 3/5 of a pizza. Jane has eaten 1/7 of a pizza. How many times more pizza has Joe eaten than Jane in an improper fraction?

can organisms naturally repair a mutation?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

In hexagonal writing and analysis of literary devices explores

a brown dog is crossed with two different black dogs. The first cross produced only black dogs and the second cross produces equal numbers of black and brown do

which of the following are examples of ways humans and plants have coevolved? Pick all that apply A. Humans have bred plants to use as food B. Plants provide a

0-4+7-5×3÷9×5-4 do the sum of that mathematics...