xxannieexx
xxannieexx xxannieexx
  • 23-03-2021
  • Mathematics
contestada

please help with this!

please help with this class=

Respuesta :

rbasat rbasat
  • 23-03-2021

Answer:

a) HK

b) EF

c) ∠J

d) ∠E

e) JKH

Answer Link

Otras preguntas

im making a poster for chemistry. the topic is acid and base. i have to make a creative title to go with the poster. any ideas?
Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?
What shape have at least 2 parallel sides
Based on your understanding of sex linkage, describe in detail why most hemophiliacs are male. Can females have hemophilia? Describe how they could inherit this
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
If 60 is 75% of a value, what is that value?
I only need to know the answers to numbers 9 and 10 The problems are the ones circled in the photo
what are the 3 care instructions for future life on earth
1. Explain the different forms of child abuse? Include Shaken Baby Syndrome in your response.
choose the correct helping verb the tadpoles have or had moved into the pond