DondreLittle279
DondreLittle279 DondreLittle279
  • 22-03-2021
  • English
contestada

Try These out 1-4 I’ll give you brainliest

Try These out 14 Ill give you brainliest class=

Respuesta :

chancejserrano119
chancejserrano119 chancejserrano119
  • 22-03-2021

Answer:

1 a

2 a

3 a b

4 c

Explanation:

Answer Link

Otras preguntas

if probability of a win is 0.24 and the probability of a draw Is 0.16, what is the probability of a loss
which of the following statements about taxes is FALSE? A-Taxes are collected a the local, state and federal level. B-Some states don't collect income tax. C-So
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what percent of 137.4 is 96
The heart sounds S1 and S2 are...?
Instructions:Select the correct answer. Read the following excerpt from the poem “On Imagination” by Phillis Wheatley .Imagination! who can sing thy force?Or w
“Just a matter of colouring...or lack of it. It is only a question of getting used to. Who is to say this colour is right and that is not?” Who is the speaker o
Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestive cavity with a single opening
find the quotient of 3870 and 18
Which prefix means 1/10 of a unit in the metric system