alexisdoyleaddison
alexisdoyleaddison alexisdoyleaddison
  • 26-01-2021
  • Mathematics
contestada

plsssssssssssssssss help

plsssssssssssssssss help class=

Respuesta :

breannaholland2001
breannaholland2001 breannaholland2001
  • 26-01-2021
Pick numbers that are small than the -4. So like -5 -9 and -4.1
Answer Link

Otras preguntas

Simplify these expressions : 6t x 2s 5a + 2b + 6a – 2b -4d2 x - 8d2 y + y + y 3(2e + 4)
What does it mean that foreign Jews were “expelled” from Sighet? Comes from the book "Night" by Elie Wiesel
A rectangle has a width of 2xy3 and a length of 4x5y6. What is the area of the rectangle?
George is folding a piece of paper to make an origami figure. Each time he folds the paper, the thickness of the paper is doubled. The paper starts out flat, wi
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
What did Russia achieve in the congress of vienna?
Which front forms widespread clouds, rain, or snow? cold front warm front occluded front stationary front
Please help me quick
Can someone please help this is due today. :)
The box plot represents the number of hours of battery life in different cell phones. What is the maximum battery life? 6 12 18 23 27 H 4 6 8 10 12 14 16 18 20