ashley123457 ashley123457
  • 25-10-2016
  • Mathematics
contestada

The Product of a number and 25 is the same as the number less 3

Respuesta :

kristenwood141
kristenwood141 kristenwood141
  • 25-10-2016
n x 25 = n - 3 :) hope this helps
Answer Link

Otras preguntas

how many branches of government are dictated in the us constitution,what are those branches??
14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?
In hexagonal writing and analysis of literary devices explores
Which naval battle forced the German high seas fleet to its harbor and this helped turn the war in favor of the allies
what percent of 137.4 is 96
Which Of The Following Can Be Found In Breast Milk? 1. Vitamin D 2. Calcium 3. Anti Bodies 4. Iron
Cardiac muscle contracts A. in response to voluntary output B in response to nonvoluntary input C. on its own without input
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Find the mean of these values 6,4,8,2,5