crisherrera67 crisherrera67
  • 22-12-2020
  • Mathematics
contestada

What is the inverse of the function f(x) = 1/4x - 12?
Oh(x) = 48x - 4
Oh(x) = 48x + 4
O h(x) = 4x - 48
O h(x) = 4x + 48

Respuesta :

leena
leena leena
  • 22-12-2020

Happy Holidays! :)

[tex]\large\boxed{h(x) = 4x + 48}[/tex]

[tex]f(x) = \frac{1}{4}x - 12[/tex]

Find the inverse. Begin by swapping the x and y (f(x)) variables:

[tex]x= \frac{1}{4}y - 12[/tex]

Begin isolating for y. Add 12 to both sides:

[tex]x + 12 = \frac{1}{4}y[/tex]

Multiply both sides by 4:

[tex]4(x + 12) = \frac{1}{4}y * 4[/tex]

[tex]4x + 48 = y[/tex]

Therefore:

[tex]h(x) = 4x + 48[/tex]

Answer Link

Otras preguntas

A video is sent to one person; on the 2nd day this person sent it to two other people: on the 3rd day each of the people who received the video sent to two othe
Genevieve deposited $400 into her bank account. The equation A open parentheses t close parentheses equal 400 open parentheses 1.07 close parentheses to the pow
Need help ASAP and orange please I’ll give brainiest
Why do most multicellular organisms have genetic variation? A-they only have one version of a gene B-their genes are being continuously reshuffled during reprod
Please help me ASAP!!!!
Pls help pls pls pls pls pls pls pls pls
transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC​
Can someone help me answer number 2 and 3 ?! Please
What causes changes in the Geological Time Scale? A. Increased rock sediments B. Evidence of prehistoric life C. Changes to biodiversity
respuestas de estos dos ejercicios 5/12 + 1/4 =4/12 + 1/4=​