ep25rxra2r ep25rxra2r
  • 23-10-2020
  • English
contestada

To say is to act
Adverb

Adjective
Noun

Respuesta :

rhianamarielynne rhianamarielynne
  • 23-10-2020
Adjective I think I’m not sure
Answer Link
alana12818 alana12818
  • 23-10-2020
adjective is the answer pretty sure
Answer Link

Otras preguntas

What is the value of x? X II m< BAE 11 m m E 4 B 2x 76° U D
A square of side x inches is cut out of each corner of a 9in. by 12in. piece of cardboard and the sides are folded up to form an open-topped box. A. Write the v
which of the following is an irrational number? A) square root of 18 B) square root of 49 C) 3.8 D) 3/10
If you were the chief of another Native American nation, would this speech persuade you to join the Federation?
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
The graph of y = -0.2x² is ____ the graph of y = x²
¿Cuáles son para ti los hechos más importantes de la Prehistoria?
a) x² + ax + b = (x-3)² - a where a and b are integers. Work out the values of a and b.​
Please help Simplify -1/2(b+2)+3b (A) 5/2b-1 (B) 7/2b+1 (C) 5/2b+2
Fill in the boxes to complete this multiplication