gailwassom
gailwassom
21-10-2020
Computers and Technology
contestada
What is an example of a LAN
Respuesta :
noahaceja
noahaceja
21-10-2020
Answer: Something businesses use to connect their computers together aka Local Area Network.
Answer Link
VER TODAS LAS RESPUESTAS ( 65+ )
Otras preguntas
The election of 1800 demonstrated that the Alien and Sedition Acts were constitutional. the electoral college worked smoothly. the US government was stable. pre
what Is the difference between organic and inorganic matter?
A patient comes into the clinic with a resting heart rate of 80 beats per minute (bpm). The patient's cardiac output was found to be 5.6 liters/minute with an e
What is the most common cause of liver failure ?
the sale price of a bicycle is $120 this is 75% of the original price find the original price
Dree rolls a strike in 6 out of 10 frames of bowling. What is the experimental probability that Dree will roll a strike in the first frame of the next game? Exp
6. Why is crossing over, or recombination, in meiosis a genetic advantage for a n organism? Why is crossing over an advantage for a geneticist
Find the commission on a $750.00 sale if the commission is 24%. $166.00 $180.00 $131.25 $201.00
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell
