syz96r4ncw syz96r4ncw
  • 23-09-2020
  • Mathematics
contestada

Evaluate: x / y x = 27 y = -3 helpp!!!!

Respuesta :

maxlarson
maxlarson maxlarson
  • 23-09-2020

Answer:

-9

Step-by-step explanation:

Answer Link

Otras preguntas

Each serving of a cereal is 80 calories. Which expression can be used to find the number of calories in 3 servings?
how is the design of a crayfish's nerve cord different from the design of a vertebrate's nerve cord?
The human body is made of a group of systems that function together. therefore, communication between these systems is crucial. describe two ways communication
(07.02) Simplify (3x − 5) − (4x + 6). (1 point) −x −11 x − 11 −x + 11 x + 11
Simplify. 16x3 - 8x2 + 4x4 ------------------------ 2x A) 8x2 - 4x + 2x3 B) 8x2 - 4 + 2x3 C) 8x3 - 4x + 2x3 D) 8x2 - 4x + 2x
A negotiation support system provides support to the negotiation process by ________.
10 POINTS AND BRAINLIEST Which set of numbers is finite? Even numbers between 1 and 89 Real numbers greater than 1 Rational numbers between 1 and 2 Whole numbe
A survey is​ valid, if it​ __________. produces distinct results in similar conditions b. includes compound questions c. measures what it is designed to measure
The immediate effect of the two atomic bombs being dropped on Japan in August of 1945 was _______.
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt