kkdietrich0420 kkdietrich0420
  • 23-09-2020
  • Spanish
contestada


Piensas que puedes hacer estas cosas para mantenerte saludable? ¿Por qué?

Respuesta :

tameraparker14
tameraparker14 tameraparker14
  • 23-09-2020

Answer : Toma un buen vaso de agua al despertarte y mantente bien hidratado durante el día. ...

Haz treinta minutos de ejercicio al día. ...

Programa siete u ocho horas de sueño cada noche. ...

Nunca comas en exceso. ...

Elige verduras antes que carnes o snacks procesados. ...

Maneja bien tu estrés. ...

Hazte un chequeo médico al menos una vez al año.

Answer Link

Otras preguntas

Click ___ to move a stacked object to the top of the stack.
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
people involved in cases that are accepted by the us supreme court must travel to washinton dc?
plz help what is the answer.
which branch of central government makes/enact/ passes laws
In chapter 1 of " To Kill a Mockingbird", what did Dill dare Jem to do? a. slap Boo Radley's house and run b. go to the town square c. play football with his me
how did Thomas Edison contribute to the Industrial Revolution
. A ski club planned a trip to Lake Tahoe, and 40 of the members signed up to go. If this is 60% of the club, how many members does the ski club have in total
If 1+4=5 and 2+5=12 what does 8+11=
In a Worn path by Eudora welty in lines 1-9 what details suggest that phoenix is in for a long journey?