turnerdevin49 turnerdevin49
  • 24-08-2020
  • Social Studies
contestada

Nevermind, I figured it out

Respuesta :

duncanf511 duncanf511
  • 24-08-2020

Answer:

Thats good!

Explanation:

Have a great day! :)

Answer Link

Otras preguntas

people involved in cases that are accepted by the us supreme court must travel to washinton dc?
Compare and contrast immune tolerance with licensing
Siri has half the amount of quarts in a gallon how many cups are in those quarts if there are 4 quarts in a gallon
Consider the following piecewise-defined function. f(x){x^2 -5, x<3
Instructions:Select the correct answer .In this line from Thomas Paine's Rights of Man, what element denotes that it is from the Revolutionary era? There exist
A patient comes into the clinic with a resting heart rate of 80 beats per minute (bpm). The patient's cardiac output was found to be 5.6 liters/minute with an e
which of the following does NOT describe the process of summation? a. Two ESPSs are generated at the same time by two separate synapses, bringing the cell to th
A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you
Whose image will replace Andrew Jackson on the U.S. 20$ bill
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC