nesstea14 nesstea14
  • 22-04-2020
  • Mathematics
contestada

1. What are the four orders of operations

Respuesta :

00026957 00026957
  • 22-04-2020

Answer:

The "operations" are addition, subtraction, multiplication, division, exponentiation, and grouping; the "order" of these operations states which operations take precedence (are taken care of) before which other operations.

Step-by-step explanation:

Answer Link

Otras preguntas

Does anyone know 12?? Will mark brainliest
Pleaseeee help meeeeee
Which element is likely to form exactly three covalent interactions with hydrogen?.
XYZ Toys makes a ec 4- Me Baby Doll for $10.40. They mark up the cost by 55%. What is the selling price for the Feed-Me Baby Doll?​
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
translate triangle a (-3,1) what do i write
climate change invites energy crisis. justify this statement​
Find the slope of each line.
What does the word brazen mean in the following line? "Not like the brazen giant of Greek fame," (line 1) A. Bold B. Lively C. Raggedy D. Sharp
A pendulum is 22.9 inches long and the bob at the end of the pendulum travels 10.5 inches. Find the degree measure of the angle through which the pendulum swing