tater88 tater88
  • 24-08-2019
  • Mathematics
contestada

2x^2-5xy-y^3
If x=-3 and y=-2
Using PEMDAS

Respuesta :

Аноним Аноним
  • 24-08-2019

Answer:

-4.

Step-by-step explanation:

2x^2 - 5xy - y^3

= 2(-3)^2 - 5(-3)(-2) - (-2)^3  

=  2*9 - 5(-3)(-2) - (-8)    

= 18 -5*6+ 8

= 18 - 30 + 8

= -12 + 8

= -4.

Answer Link

Otras preguntas

a speech is considered what type of text
Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region. which muscles are most likely to be involved in this injury?
I only need to know the answers to numbers 9 and 10 The problems are the ones circled in the photo
how to solve these questions?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
I only need to know the answers to numbers 9 and 10 The problems are the ones circled in the photo
A survey shows that 67% of peanut butter lovers prefer chunky style. Out of 850 people surveyed hoe many can be predicted to say they prefer chunky style peanut
a water sample could be negative for enterococcus and coliforms and still be a major public health threat. why? Why can filitration be used to sterilize culture
Dr potter provides vaccinations against polio and measles. Each polio vaccination multi-dose vial consists of 44 individual doses, and each measles vaccination
Consider the combustion of octane (C8H18) 2C8H18+25O2-> 16CO2+18H2O How many grams of CO2 are produced when 191.6g of octane are burned?