djdksj djdksj
  • 26-04-2016
  • Chemistry
contestada

The mass percent of oxygen in CaO is (8 pts)
a) 28.5%

The mass percent of oxygen in CaO is 8 pts a 285 class=

Respuesta :

miss2and22
miss2and22 miss2and22
  • 26-04-2016
what is the rest of the choices but I do think it is a
Answer Link
ghaniraza14 ghaniraza14
  • 26-04-2016
add the reltive atomic mass of Ca and O which are 40 and 16 respectively after addition we get molecular mass of CaO which is 40+16=56 now divide atomic mass of O by molecular mass of CaO and multiply it with 100 as show n 16/56 *100=28.57%
Answer Link

Otras preguntas

The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri
what other fields of the study might contribute to knowledge and understanding in art history?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
How can an iceberg (temperature=0 Celsius) have more energy than a burning match head (temperature=230 Celsius)?
Does this represent a linear function?
How did the French National Assembly treated religion
Indigenous North American societies recognized and even valued a gender status known as (Points : 1) intersexuality. Two Spirits. Hij
If 60 is 75% of a value, what is that value?
Discussion the following: Compare and contrast 1. a. Niacin b. Folate c. B12 deficiency d. Riboflavin Thank you
What does the equation -355-n=-957 what does n equal?