nat3011 nat3011
  • 21-10-2018
  • Mathematics
contestada

the percent of sales tax is 6%. what is the sales tax on a skateboard that cost $98

Respuesta :

homebeebti homebeebti
  • 21-10-2018

98 times .06 is $5.88

Answer Link

Otras preguntas

Can someone please help? :)
Popular sovereignty is the idea that: A) there are some rights that are fundamental regardless of whether they are popular B) i’ll government gets his power fro
Compare and contrast canning packaging used two hundred years ago to what is used today.
The quotient of sixty-four and a number is four. What is the number? 64 divided by question mark = 4 O 12 O 16 O 60 O 68
PLEASE HELP MEE THIS IS URGENT
1. Which is NOT true about Muhammad Ali?  A. He changed his name to Cassius Clay B. He won a gold medal in the Olympics C. He started boxing after his bike was
transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC​
Terri rode her bicycle for 7/8 mile. Simon rode his bicycle for 4/6 mile. How much farther did Terri ride her bicycle? 1 13/24 miles 3/2 miles 5/24 mile 11/14 m
has anyone heard nf new song clouds if so what do you think about it
give me ans please......……………………​