gwenette70 gwenette70
  • 22-08-2018
  • Mathematics
contestada

the Moon is about 240,000 miles from Earth what is the distance written as a whole number multiplied by a power of 10

Respuesta :

Аноним Аноним
  • 22-08-2018

The answer is 24 x 10 ^4

Answer Link
danicagarza danicagarza
  • 22-08-2018
the anwser is 24×10^4
Answer Link

Otras preguntas

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
SPANISH SPEAKERS, PLEASE HELP ME! Parte A- Follow the directions below to complete the assignment: ● For number 2 choose two of the tourism choices and explain
What is -78.6 (-2.4)? A. -188.64 B. -32.75 C. 32.75 D. 188.64
You are on the 18h hole at the Dallas Country Club you know that the distance from the tee to the hole is 182 yds you have hit the ball 168 yds as shown below d
How did Hitler’s belief lead to the persecution of Jewish people?
A computer is worth $400 when it is new. After each year, it is worth hall what it was the previous year What will its worth be after 4 years? Round you answer
Help ASAP!! I will give brainlist! Thank you!
i have no idea how to do this pls help
What are the theme for each act 2 Romeo and Juliet
Where did Victor villasenor grow up?