21-08-2018
Mathematics

contestada

what is the solution to the system of equations below? y=-3x-9 and y=1/3x-39

Respuesta :

yuzaria15 yuzaria15

21-08-2018

To remove fractions, multiply equations by their respective LCD
Multiply equation [2]by 3

Answer Link

Otras preguntas

What is the executive branch made up of

If (4 to the 4 power) to the x power = 4 to the 32 power, what is the value of x?

what are all the stages of the cell cycle and mitosis

graph f(x) = -1.5x + 6 Thank you!!!

HELP PLEASE! WILL GIVE BRAINLIEST! Write in complete sentences to explain what a budget is, how to make one, and how to balance it.

What is most likely to happen if an individual restricts consumption of dietary fat to very low levels? A. loss of hemoglobin from red blood cells B. develop

True or False: Cold temperatures could be an example of a stimulus.

the solvent agent for oils is?

DNA tacaggtacccgaacccaattta

What are two ways that diatoms differ from slime molds? Choose the correct answer from the drop-down menu. The external coverings of diatoms are made up of [pep