indiaarie06 indiaarie06
  • 21-06-2018
  • English
contestada

A useful statement of a main idea is typically

Respuesta :

jorgepollo
jorgepollo jorgepollo
  • 21-06-2018
im sure you are talking about THESIS 
Answer Link

Otras preguntas

Pleaseeee help meeeeee
I can't find brainly tutor and I paid for it do yall know were it is?? ​Comment if you know
forgot how to do this Use distributive property to expand -6(a-5)
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
how did individuals, both Americans and others, show heroism in the American revolution? with a paragraph about two individuals explaining why they should be ca
In the space below, write a paragraph that answers the Essential Question: What are the main beliefs and teachings of Buddhism? Be sure to include each Social S
Identify the part of speech of the underlined word
Solve the following system of equations graphically on the set of axes below.y=-2x-7y=3x-2
Which of these is true of affluent people?
Can y’all help me please ?