cjasmine9049 cjasmine9049

24-04-2024
Mathematics

contestada

Which shows 467 in expanded form?
1) 600+70+6400+60+7700+40+6700+60+4
2) 400+60+7000+70+6000+40+700+60+4
3) 600+70+6400+60+7700+40+6700+60+7
4) 400+60+7000+70+6000+40+700+60+7

Respuesta :

Otras preguntas

What is the answer to 8xsquared-24x

:Select the correct text in the passage .Which lines in this excerpt from Phillis Wheatley's poem "Goliath of Gath" contain examples of figurative language? The

Which is not an improper fraction equal to eight

Mantle convection is a circulation of heat emitted by the earths... A) core B) crust C) lithosphere D) atmosphere

1+4=5 2+5=12 3+6=21 8+11=

Matt had to write 3 4/12 as an improper fraction right how you would tell Matt the easiest way to

1) If X = 2, calculate the value of: 2x squared - x 2) if X = -2, calculate the value of: 2x squared -x

list the six external parts of a computer system and identify which are output and which and which are input devices

How many cm has a inch

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC