swartzaf29
swartzaf29
26-03-2024
Mathematics
contestada
24≥58+5(x-3.8) solve it
Respuesta :
VER TODAS LAS RESPUESTAS ( 74+ )
Otras preguntas
Please Answer 6. Find mABC 7. If mPQ =(5x +17)° , find x. 8. Find m∠1
pls help. due today. answer ASAP. will give brailiest to person who includes at least one of each factor in their response. what environmental and genetic facto
During the colonial era get American south developed very few urban areas which resulted in a
1.125 inches of rain fell in 2.5 hours. How many inches of rain fell per hour?
Earth rotates on its axis once every ___________. a 365.25 days b 24 hours c 30 days
Fred had 21 peaches left at his roadside fruit stand. He went to the orchard and picked more peaches to stock up the stand. There are now 66 peaches at the stan
Harold cut 18 1/2 noches of ropero that was 60 inches long how much is the length of the remaining rope un inches written un decimals f From
Arrange the following atoms in order of decreasing atomic radius
transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC
Why do we negotiate or debate? Is it important to do this in the world? Why. 4 sentences please answer for brainlest answer