ck424242 ck424242

26-02-2024
Biology

contestada

fill in with the mRNA strand, then translate to the amino acid sequence using this chart. Remember to always start with the start condon, and end with the stop condon. (Condon = 3 rucleotides) DNA: ATGTTTGCATACCAAGGCTAAATTTTC TRANSCRIPTION: mRNA: pROTEIN (AMINO ACID SEQUENCE): Translation

Respuesta :

Otras preguntas

The bailout declaration declared that Britain would do witch of the following

sam purchased a used car for $15000. He paid 6.3% sales tax. How much tax did he pay?

The two parallelograms in the figure are similar. What is the value of x? A. 26 B. 24 C. 28 D. 30.4

a paint can has a diameter of 17cm and a height of 24cm. what is the surface area of the can?

who has the symbol of peace

Select the participle or participial phrase in the box below. Also select the noun or pronoun modified by the participle. A person observing a crime should ca

How is acid rain produced ?

Cases of sids (sudden infant death syndrome) may be subject to criminal investigation because the

What is the amplitude, period, and phase shift of f(x) = −4 sin(2x + π) − 5? Amplitude = −4; period = 2π; phase shift: x = -pie/2 Amplitude = −4; period = π;

Work is measured in _____. newtons watts joules newtons/sec