kaanan8459 kaanan8459

22-05-2023
Biology

contestada

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3'

Respuesta :

Otras preguntas

how we know that ancient civilizations knew of and were concerned about infectious diseases

Which solid figure has six vertices? A: Rectangular Prism B: Square Pyramid C: Triangular Prism D: Hexagonal Pyramid

is flower color a charecteristics or a traits

Which of the below statements is not true about Arlington National Cemetery?a) It's the only cemetery in the country with veterans from all U.S. wars.b) The lan

how do you solve this?

A bag contains 10 red chips, 8 white, 6 blue, and 8 yellow. You randomly pick one chip from the bag. Without replacing the chip, you randomly pick a second chip

What Is Multiliteracy?

Can you write an expression for the number of miles george travels in h hours, George drives 45 mi/h?

What European island nation is located at 20 degrees W and 63 degrees N?

who was cleopatra's mother