audi1000
audi1000 audi1000
  • 22-05-2023
  • Spanish
contestada

Llena el espacio con la traducción de la forma correcta del adjetivo posesivo enfatizado.

Este guante mío es nuevo.

Respuesta :

Otras preguntas

What is 4x+3x? Write solution.
Type a digit that makes this statement true. 6,105, 77 is divisible by 3. HELPPPP MEEEE PLZZZZ!!!!!
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
The approximate average distances from the sun to Mars and Mercury are listed below: Mars: 2.28 x 108 kilometers Mercury: 5.79 x 107 kilometers How many times f
Why does the lawmaking process take so long?
A parabola can be drawn given a focus of (4,6) and a directrix of y = 2. What can be said about the parabola?
Cellular respiration is an examole of. A. Catabolic pathway Anabolic pathway . Extracellular activity D. Thermodynamics
Why were some Americans Anti-Imperialists in the late 19th and early 20th Century?
Help me solve for x please :))
Write the equation of a line that is perpendicular towards y = -6x +5